EST details — SGN-E352279

Search information 
Request: 352279Match: SGN-E352279
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C160878Clone name: cTOS-13-P18
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E352279Length: 620 bp (899 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E352279 [] (trimmed) CAAAATTCATCATCTGTCCAGCCTGTTGTAGCCGTTGAACGTACTGTATTTTACAGAGAAAAAGCTGCTGGAATGTATTCTGCCATACCTTACGC
CTTTGGACAGGTTGTCATCGAAATACCTTATGTATTTGTACAATCAGCTTTCTATGGTGTCATCGTGTATGCAATGATCGGGTTTGAATGGACTG
CTGTCAAATTCTTATGGTACTTCTTCTTCATGTACTGCACCCTCTTGTACTTCACCTTCTACGGCATGATGACAGTGGCTGTTACTCCAAACCAA
AACGTTGCATCCATTGTCGCGGCCTTCTTCTATGCAGTATGGAATCTCTTCTCAGGATTCATCGTTCCACGACCTCGTATTCCAATCTGGTGGAG
ATGGTACTACTGGGCTTGCCCTGTTGCATGGACCTTGTATGGTCTCGTTGCATCACAATTCGGAGACATCCAAACTCCTCTCACCGATGATGAAA
ATGTTGAACAATACTTAAGACGTTACTTCGGATTCAAACATGATTTCCTTGGCGTTGTTGCTGCTGTGATCGTCGCGTTGCCTGTTATGTTTGCG
TTGACATTTGCATTANGCATTAAGGCCTTCAACTTCCAGAGAAGATAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E352279] SGN-U578663 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T165894 [Download] [View] Facility Assigned ID: TSCBZ93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0118 Quality Trim Threshold: 12.5