Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E352425

Search information 
Request: 352425Match: SGN-E352425
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C167402Clone name: cTOS-9-F16
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E352425Length: 340 bp (934 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E352425 [] (trimmed) CACCCGCACTTGCTCCCCCAGAAGTACAAATTGACTTAGCTGCACAGGCATTGCATGAACAGGAGCTTCAAGCTGCCCTTAATCAGCCACTTCCT
GATGACGATGATGAAGCATTTGAATAGATGGCAGAGATTAGTTTCACTGTTGCACCTTTCCATATTTCTAGTCCTTCAATTTTCTCTATTTGGAC
TTTTGTATTTGTTTGAGGATTTATTTGCTGCTTCCTTGTATTATTGATTGGTTATTAGATATGTTTGTCTGGGGCAAATGAGGCTGTGTTTTGTT
AGGTTAGATATTCTGATCTTGATGTAGGTGTTGAGGCTCTGTTCTGAGCTTGTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E352425] SGN-U580926 Tomato 200607 Build 2 50 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T164409 [Download] [View] Facility Assigned ID: TSCBJ32TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5