EST details — SGN-E353141

Search information 
Request: 353141Match: SGN-E353141
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C161039Clone name: cTOS-14-G7
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
See unigene SGN-U582445 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E353141Length: 585 bp (869 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E353141 [] (trimmed) GGAAAAGCTTAACGTACATTAATTTGTCGTATAATAAGCTTGTTGGAACTATCCCAGCCTCGCTATCGCAACTTCCATATTTGGAATTTTTACGA
TTAGATAGGAACAAATTGACTGGACCAATACCGGAGTCGTTTAGCAAATTAGCTCCCAATTTAACGTATCTTTACCTTGGGCATAACCAACTTAC
AGGGATTGTACCAATTTCATTTGCTGGGTGGAGTTTTGACACAATTGATTTGTCAAGGAACATGCTTGAAGGGGATATTTCGTTTTTGTTTGGTA
AAGATAAGACTACGTTTGAAATGTTATTGGATCGGAATAAATTTGAATTCGATATGTCAAAATTGACGTTTGGGAAGGGGTTATGGAGGTTGGAT
TTGAGTCATAATAAGATTTATGGGAGTATACCGAAAATAATATCGAAGAATCCGTGGCAAATTTTGAACGTGAGTTATAATAGACTTTGTGGAAA
GATTCCAAAAGGTGAGAATATGCAGAAATTTGAGATATATGAGTATTTTCATAACAAATGCTTGTGTGGTGCTCCGTTGCCGCCTTGTAAATGAT
CATCACTAGCGTAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E353141] SGN-U582445 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T166091 [Download] [View] Facility Assigned ID: TSCCA40TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0069 Quality Trim Threshold: 14.5