Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E353348

Search information 
Request: 353348Match: SGN-E353348
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C161277Clone name: cTOS-15-C10
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: Alias clone SGN-C186327 is on microarray TOM1: SGN-S1-1-4.4.5.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E353348Length: 498 bp (887 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E353348 [] (trimmed) GATCGGACCGGTGGATTTTCACCATGACACCACCATTCTTTTCAAGAGGTTCATCAATGAAATCACCCAGAGTTGGAGCTGAAGCCGGCGAGGGT
TCCACCTCAGGGAGTATGAGAACCGCCGTCAAATTGCCGTCGTTTAAATGCTTGGAACCAAAAGGCGATGAAGCCTCATTGATGTCGACTGACTC
GGCTCGACCGCCGGTTTAATAATCCGGTTCGAAGTCAAACCGTAATGATTCGCAAAGACTTTTCATGGGCTATAGGAAAGGGGAACGTGTTTTTC
ATGATAGATTGGGCCCCCGCTTTGAATTAACAAGCCCAAACTTGACTCTAAATTTATTTTTTCGAGAAAAGCATTTTTGTTTTTATTTTTTTGTT
ATATAATTGAAAAATCTTTAAGTTTTTCCTTTTTCTCGTTTTAAAGATATAGTGCATATCAATAGTTGATGTAAGTGTAACCAAAAAATCACTTG
TAATTTTATTTATTTTTCCTTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E353348] SGN-U572830 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T166298 [Download] [View] Facility Assigned ID: TSCCF17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0002 Quality Trim Threshold: 12.5