Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E353349

Search information 
Request: 353349Match: SGN-E353349
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C161279Clone name: cTOS-15-C12
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E353349Length: 669 bp (892 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E353349 [] (trimmed) CCGACATCTAAGGTGACTGTAGGAGCTTCTTTTCTGTCTCAACAATAGCCTTGCAGGACTCAACTACAGTTAAATTTGAAATATGGGACACAGCT
GGTCAAGAAAGGTATGCAGCTCTTGCACCATTATACTACCGAGGTGCTGCAGTTGCAGTGGTTGTGTATGATATAACTAGTCCTGAGTCTTTTGC
CAAAGCACAATACTGGGTCAAGGAACTGCAAAAACACGGGAGCCCTGATATAGTCATGGCTCTGGTTGGCAACAAAGCCGATCTCGACGAGAAAA
GAGAAGTAACGACACAAGATGGAATTGACTGTGCTGAAAAGAATGGCATGTTCTTTATAGAAACATCTGCTAAGACAGCTGATAATATCAACCAG
CTGTTTGAGGAAATCGCGAAGAGATTGCCACGCCCTACTGTTGCTTGACCATCAAGATTATGCTAATTGCTACTGTACTGCCTGTAATACTATGT
ATATGAGGTCATTCTCAGTCTCTTTTTCTCTGCAGTACTCTCTCTTGTTACGTTTCCTGATCTCGTGATCGCGATCCTCTTCAACGAGGCATCCT
GATATATATATATATATAAACTGTGAGAATTGAGGAGACTAATTAACTCACTTCACCTTTGTGAAAAGTTGAAATATTTGAATGGTTCAGTGACA
TATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E353349] SGN-U584392 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T166299 [Download] [View] Facility Assigned ID: TSCCF18TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0087 Quality Trim Threshold: 12.5