Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E353957

Search information 
Request: 353957Match: SGN-E353957
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C103211Clone name: cLHT-6-E23
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
See unigene SGN-U585837 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E353957Length: 548 bp (919 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E353957 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAACAAGCAAAAGTTAAAATGATGCATTTCACTCAATCTACAAGCAGTGAACAAATAAAGCTG
TTAAAAATTCAAGACTACACTAGAAAAACAAACATTTTTATAGGGGGTTTTCTATTCTTACAAAATGCCCAAACTTGCACTTAGTGGTGCTGTAC
TATTCTGGTGACCTATTTCTATGATCATTTTACTTTGGCATCTGTAATATTACACACTGGAAATTATTAGACCATCATCACTGCTATCATCTATT
ACCTTATTGGAATTAATACGTTTGTAACTAGCAATGTATTTTTCGCTGTTGTTCCCGCTAAGGAGAGGAGCAACATCATACTCTGTATCTGGTGA
TTTTCCTCCAGAATACCTAAAGGACTTGCATCGATGAAGTATCTGCAGAATCTCTTTCATGGAAGGCCTGCTCGCAGGTAAGTTGCTCGTGCATA
TAAGCCCGAGTCTGAACACTGTCTTCATTTCTTCCAAGTAACATGTTTCTTTGATATCTGGATCTAACATATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E353957] SGN-U585837 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T169845 [Download] [View] Facility Assigned ID: THTAU36TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0134 Quality Trim Threshold: 14.5