Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E355329

Search information 
Request: 355329Match: SGN-E355329
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C162294Clone name: cTOS-18-D11
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: Alias clone SGN-C186331 is on microarray TOM1: SGN-S1-1-8.4.5.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E355329Length: 456 bp (860 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E355329 [] (trimmed) TGAGGTCATACACTTGGTCCGATGGGTTCATTCGGTTGTCCGAGAGGAGTGGACTGCTGAAGTATTCGACTTGGAACTATTGAGGTACCCAAACA
TAGAGGAAGAAATGGTGGAAATGTTGCAGATAGCCATGTCTTGTGTGGTAAGGATGTCAGATCAAAGACCAAAAATGTTTGAAGTTGTTAAAATG
ATCGAGAACGTTCGTCCCACGAGCTTAGAGAATCAGCTTTCATCTGAAGGAAAAGCAGAAACTTCAACCCCAAGAGAAGAAGCCACACCTCTGCC
TGATACACAATCTGATTCTCAATGAGTTTGCCATTTTTATCATAGATTACCATCTTAATTCATGTTGAAAAATGCTTTACTTCACTCTCTCACTG
AAATTATTGAATACTTTGTAACTTAATTCCAATAAGCGCTTTATATTAAGTATTCTTGAAATAGTACTTTGATTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E355329] SGN-U583982 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T167514 [Download] [View] Facility Assigned ID: TSCCS18TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0128 Quality Trim Threshold: 12.5