EST details — SGN-E355462

Search information 
Request: 355462Match: SGN-E355462
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C164890Clone name: cTOS-25-C23
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
See unigene SGN-U568655 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E355462Length: 541 bp (886 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E355462 [] (trimmed) GGCATTCTGCCAGTTTGTTACTGGTGCTCCTCGGCTCCCCGCAGGTGGTCTTGCTTCTCTGAATCCTAAGTTGACAATTGTGAGGAAGCATTCAT
CTAGTGCTGGCAATGCAGCACAGAACAGTAATGCCCCATCAGAATCTGCAGATGAAGACCTACCCAGTGTGATGACATGTGCTAATTACTTGAAA
CTCCCTCCCTATTCTACTAAGGAGATCATGTCCAAGAAATTACTCTATGCCATTAATGAAGGTCAAGGATCGTTTGATTTGTCATAAGTCGGAGT
AACTAATAGACTTGTTTATACAACTCGAGAATTGGTGCTTCTGATCCTTGATAATGGTGCCGTCAAACCACCCTCTTCAAACTGACAATAGCAAG
GTCTGTAAACACCTTGTGGCATTGATAGATTATGTGTCTACTTGTTTCTGCTACCTTTATTATTTAATTACGATTGTTTCGTTAGTTTTCAGGTA
AGTTATGTAGATTGCATATTGAGTATTTGTTTCTTGTCTAATATATCAGATTTAGCTTGCTGTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E355462] SGN-U568655 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T169617 [Download] [View] Facility Assigned ID: TSCDS24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5