EST details — SGN-E355767

Search information 
Request: 355767Match: SGN-E355767
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C101390Clone name: cLHT-18-J17
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193849 [TUS-69-E15] Trace: SGN-T346972 EST: SGN-E546097 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193849 [TUS-69-E15] Trace: SGN-T346973 EST: SGN-E546098 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E355767Length: 565 bp (826 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E355767 [] (trimmed) CAAAGTAAAATAAAATTTTATCGACCACACACAATAATCTTTCAATCCTAGATAACGATTTTGCTAGAAAAAAAAAATACATGTTGATGATGGAA
GAAGCGAGGTCGAGAAAGCTAGGTGGCTCTTTGAAAGTTCCTAACGTTCAGGAGCTGGCAAAACAACAACTAGCAGGTGTTCCATCGCGATATAT
TCGTGTTAATGATGACGAAAATCAATTGTATAATTCTTCCATATTATTGCCTCGTGAATTAGCTCCAGTTATTGACATGAAAAAACTGCTCAAAA
TAATTAAAGACGATGATACAGAGCTTAACAGGTTTCATCTTGCTTGCAAAGAATGGGGATTTTTCCAGTTGGTGAATCACGGAGTGAGTTCATCA
TTGATGGAGAAAGTGAAGTCAGAAATCACAGCATTTTTCGATCTACCAATGGAAGAGAAGACGAAATTCGAGCAAGAGGAAGGAGATATCGAAGG
ATACGGACAAGCATTTGTTGTATCTGAAGAACAAAAGTTAGACTGGGGTGACATGCTTTACATGATCACTCTTCCTACTCATTTGCGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E355767] SGN-U586249 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T170609 [Download] [View] Facility Assigned ID: THTCS57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0082 Quality Trim Threshold: 14.5