EST details — SGN-E356452

Search information 
Request: 356452Match: SGN-E356452
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C101629Clone name: cLHT-20-I18
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193865 [TUS-69-F7] Trace: SGN-T347000 EST: SGN-E546125 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E356452Length: 488 bp (872 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E356452 [] (trimmed) GATGGAGCTTTAGTTGGCCTACCTGGAGTAGATGGATTGTCAACAGATCAAAGGAAAAGGTTGACGATTGCAGTTGAGCTTGTAGCCAATCCTTC
AATAGTTTTTATGGATGAACCTACTTCAGGACTAGATGCGCGGTCTGCAGCCATTGTAATGAGAACAGTGAGAAACATTGTCGACACTGGAAGAA
CAATCGTCTGCACCATCCATCAGCCTAGTATAGATATCTTTGAATCATTTGACGAGCTTTTGCTCATGAAAAGAGGTGGACAGCTCATTTATGCT
GGTTCACTAGGGAACAGATCATGCAAACTTATTCAGTATTTTGAGGAAATTCAAGGAGTTCACAGAATTAGGTCTGGACAGAACCCTGCTGCTTG
GGTTCTTGAAGTTACTTCTTCAGCAGAAGAAAATCGCCTCGGTGTAGATTTTGCTGACATTTATCGAAAATCGACTTTATTCCAGCAAAATGAGG
AAATGGTTGAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E356452] SGN-U601025 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T171462 [Download] [View] Facility Assigned ID: THTCZ57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0094 Quality Trim Threshold: 14.5