EST details — SGN-E356718

Search information 
Request: 356718Match: SGN-E356718
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C163559Clone name: cTOS-21-C14
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E356718Length: 375 bp (911 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E356718 [] (trimmed) GGCTATCTTCTTGCTGGATACTTTTCCTATATTTGTGGCTTAGCCTTGGCTCCTTACATAACATTTTATCCCATGGCCGCCATTGGGTTTATATC
ATGTGCTTTTAGGATCATAGAGAAGAGAAGTAGGGAAAAGGGGGAAATGTACCATCACCGTAGGAAACACTCTCATAAACACTAAAGTGAAAATA
CTCCCACTATACGATAGTGCCACATTCAGAATGGTTCTGCAATAGATGTTCTAGTTGACATGCCTCAATTTGTTTGATGTGTAATTTTCATTTTC
AGAGGAGTAGAATATCAGCTTGTGTATGGCTTTAATTCTACAAGTGATTCAATCATTATATTTGTCGCAAAAATTTGTTTATGGTCTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E356718] SGN-U572222 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T168399 [Download] [View] Facility Assigned ID: TSCDD19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5