EST details — SGN-E356763

Search information 
Request: 356763Match: SGN-E356763
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C163741Clone name: cTOS-21-L11
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E356763Length: 490 bp (943 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E356763 [] (trimmed) GATTATTTCTTCTCTCTCTCAAAAAATTGTGAAAATGGCACAATCCATTCGTTTCTTTGCTACTTTGTTTCTTCTAGCCATGCTTGTTATGGCTA
CTGAAATGGGACCAACGAGAATCGTAGAGGCAAGACATTGTGAGTCGTTGAGCCATCGTTTCAAGGGACCATGTGTGAGCGATAAGAATTGTGCC
TCGGTTTGCGAGACCGAAAGATTTTCCGGTGGTAATTGCCGTGGATTCCGTCGCCGTTGCTTTTGCACCAAGCCATGCTAAATAAATAATTTTGA
TTTTTATGTGTAAAAGAAGAAGTTTGAGAAGAAAAAAAATATTATGTAATTTTGAATAAAGATGTATTGTAATGCTAGTTTTGTTTGTAAAAACT
AGTTGTGATCTTTGAATTTGTATGCAATTATGGTGCACTAGACTTGTAATTCTTCATGTGGTGTATTTTTATTTTTATTTTTGAAATATTATAGA
TAAAATTTGTCTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E356763] SGN-U581633 Tomato 200607 Build 2 51 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T168444 [Download] [View] Facility Assigned ID: TSCDE66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0003 Quality Trim Threshold: 12.5