Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E356909

Search information 
Request: 356909Match: SGN-E356909
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C163906Clone name: cTOS-22-D19
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E356909Length: 680 bp (939 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E356909 [] (trimmed) GGACAGCTATACTCTAAGGATGTTCTGTATTGCTTTTACAAAGAAGCGTCCAAACCAACAGAAGCGTACCTGCTATGCCCAGAGCAGCCAGATCC
GTCAGATCCGCAGGAAGATGGTTGAGATCATGAGGAACCAAGCCAGTTCCTGTGACTTGAAGGAGTTAGTTGCAAAATTCATCCCCGAATCAATT
GGCAGGGAGATTGAGAAAGCAACTTCCAGCATCTTCCCCCTACAAAATGTCTATATTCGAAAGGTCAAGATCCTCAAGGCCCCTAAATTTGACCT
TGGCAAGCTGATGGAGGTTCATGGTGACTATTCAGAAGATGTTGGTGTGAAGTTGGATCGGCCAGCTGATGAGACAGTAGCTGAGGCAGAGGCCG
AGGTTCCTGGATCTTAGACTTGTTTCATCCATCGAGTTACGTTACCCAATATGGTGGTAGTCTTTAGAGCATCACATTGTTTAAGTTGAGTTTTG
TTGTGACATCTGAAAATTTTGCATCTGGTTCTTTGCCTATGTTTTATCCATACATTATCATAGACCAAGATATGGATTTTCCAGCTGTTTTATCT
ATTACTAATTTCTTTCCCGTATGTTGAATTATGTCATTGTGGAACTTGGTAATTCATGCTTTTTTGTAAAGCTTCGCAGGAGATTCATTTCTCTT
TGTGCTTGCCTTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E356909] SGN-U579808 Tomato 200607 Build 2 82 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T168590 [Download] [View] Facility Assigned ID: TSCDI22TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0036 Quality Trim Threshold: 12.5