EST details — SGN-E357155

Search information 
Request: 357155Match: SGN-E357155
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C101282Clone name: cLHT-17-H15
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193830 [TUS-69-D20] Trace: SGN-T346941 EST: SGN-E546066 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E357155Length: 492 bp (865 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E357155 [] (trimmed) TTGGTTCAAAATGGAGCTAACTAATTCAAGAGGTACTAGTTTAAGAGAAAAAATAATCAGGGGAAGTAGTTTGAGAGGGAGCTTAAGTAGAAAGA
GGAATAGTACTAACAACTCCAGGTGGAATGGCAATGATGGGGAGATTTTTAATCGTTCAACGAGAGACGAAGATGATGAAGAGGCTCTTAAATGG
GCAGCTCTTGAAAAACTTCCAACGTTTGATCGTTTGAGAAAAGGTCTCTTGTTTGGATCACAAGGTGCATCTGCTGAAATTGATATACATGATAT
TGGTTTTCAAGAAAGAAACAAGTTGCTTGAAAGGCTTGTCAAAGTTGCAGATGAGGATAATGAGAAGCTCCTGTTGAAACTCAAGCGAAGAATTG
ACAGAGTTGGGATAGATTTGCCTGAAATAGAAGTTAGATATGAGCATTTAACTATTGAGGCAGATGCATATGTAGGAAGTTGAGCTTTGCCTACA
TTTATCAACTTTATCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E357155] SGN-U574714 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T170820 [Download] [View] Facility Assigned ID: THTCO44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0088 Quality Trim Threshold: 14.5