EST details — SGN-E357161

Search information 
Request: 357161Match: SGN-E357161
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C101314Clone name: cLHT-17-L17
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193839 [TUS-69-E5] Trace: SGN-T346955 EST: SGN-E546080 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193839 [TUS-69-E5] Trace: SGN-T346956 EST: SGN-E546081 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E357161Length: 457 bp (875 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E357161 [] (trimmed) CCGTCTATATTGAAAGACTTGGCAAGATTGAACCTACTAAACTTATGAACGTTACCACAATAGAAAGGTTCTTAAAGTATCACATCCAAGGGTTT
GAAAGGACTTTTGCTGAAAAATTTCCAGCATGTTCGATCGCATCTAGGAGGCATATAGATTCATCTACTACAATCTTGGATGTTCAAGGACTGAA
TTGGAGGAGTTTTGGGAAACTTGCCCATGATTTGGTCATGCGCATGCAAAAGATAGATGGCGACAACTATCCAGAGACATTGCACCAAATGTTTA
TTGTCAATGCTGGAAATGGATTTAGATTTCTATGGAATACTGCAAAAGGATTTCTTGATCCAAAGACAACAGCAAAGATTCATGTATCGGGAAAC
AAATTCCAGAGCATCTTAGCAGAAGTCATAGACCCCAGCCAATTGCCAGATTTTCTTGGAGGAACCTGCTCATGCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E357161] SGN-U580505 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T170826 [Download] [View] Facility Assigned ID: THTCO69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0124 Quality Trim Threshold: 14.5