EST details — SGN-E357222

Search information 
Request: 357222Match: SGN-E357222
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C101310Clone name: cLHT-17-J9
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193834 [TUS-69-D24] Trace: SGN-T346947 EST: SGN-E546072 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193834 [TUS-69-D24] Trace: SGN-T350186 EST: SGN-E549311 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E357222Length: 484 bp (830 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E357222 [] (trimmed) TGTGTTGCGCAAAGATGCCAATCCAGAGCTTGCCTTAGCTGTTGATATATGGAGCCTGGGCTGTACTGTTATTGAGATGTTTACTGGACAGCCCC
CTTGGGGCGAACTTAGTTGGGTGCAAGCAATGTTCGGTGTCCTGAACAAATCACCACCTATACCAGAAAAATTATCATCAGAAGGAAAAGATTTC
CTTCAGTGCTGCTTTCGGAGGAAACCTGCAGATAGGCCATCAGCTATGATGCTACTTGAACATGCTTTTTTACGTAGTACTAGTTCCCTTGAGCA
TAGTATCAATGTTGCTGGTTGCTCAGAGGATTCTCCGGGGAAGAAATTCCATGATACCCTGAGTCCTAAGAACCCAATGAACCACAAAATGGAAC
AAAAACCACTATTACCAGGAACATCTGGCTGGCAAGCAAAATCACCATGTAGCAGTGAAACTTGCCGGCAAACTCAACCTGAAACCTGTGAATAT
GGAGCAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E357222] SGN-U583415 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T170887 [Download] [View] Facility Assigned ID: THTCO53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0154 Quality Trim Threshold: 14.5