EST details — SGN-E357427

Search information 
Request: 357427Match: SGN-E357427
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C164479Clone name: cTOS-23-P10
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
See unigene SGN-U582445 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E357427Length: 647 bp (922 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E357427 [] (trimmed) AAAAGCCTTAAGTTTACTCCCTCAATTATTCATCAACATTCAAAGAGAAGTTGAAATACATAAAATAGACAAACAGATAGACAGATACATAACTT
ATATTATCCACTTTTACGCTAGTGATGATCATTTACAAGGCGGCAACGGAGCACCACACAAGCATTTGTTATGAAAATACTCATATATCTCAAAT
TTCTGCATATTCTCACCTTTTGGAATCTTTCCACAAAGTCTATTATAACTCACGTTCAAAATTTGCCACGGATTCTTCGATATTATTTTCGGTAT
ACTCCCATAAATCTTATTATGACTCAAATCCAACCTCCATAACCCCTTCCCAAACGTCAATTTTGACATATCGAATTCAAATTTATTCCGATCCA
ATAACATTTCAAACGTAGTCTTATCTTTACCAAACAAAAACGAAATATCCCCTTCAAGCATGTTCCTTGACAAATCAATTGTGTCAAAACTCCAC
CCAGCAAATGAAATTGGTACAATCCCTGTAAGTTGGTTATGCCCAAGGTAAAGATACGTTAAATTGGGAGCTAATTTGCTAAACGACTCCGGTAT
TGGTCCAGTCAATTTGTTCCTATCTAATCGTAAAAATTCCAAATATGGAAGTTGCGATAGCGAGGCTGGGATAGTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E357427] SGN-U582445 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T168988 [Download] [View] Facility Assigned ID: TSCDN89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5