EST details — SGN-E358115

Search information 
Request: 358115Match: SGN-E358115
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C102024Clone name: cLHT-23-D10
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193969 [TUS-69-J15] Trace: SGN-T347179 EST: SGN-E546304 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E358115Length: 451 bp (911 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E358115 [] (trimmed) GCTTTTGTTCTTCTCTGTTCCCATATTATAAAGGCATATTCAAAGAATAACCTCCTCCTGTTGGGATCACCTTATGCCTCACCATTCAAGTTGCA
CTTCTCTGTATGAGGCGATCGGTCCTCATTTTGATTGCTCCAACAACAACAACGTACCTAGTGATCCCACAAGTGGTGTGGTGTTTGGGGAGGGT
ACGGTTATCCATAATGTTTGGATGGGGTGCAAGGAGGAGTGACAACTCCAAGTACTATGAGGTTCTTGGTGTTTCGAAGAATTCCAGTCAAGATG
AACTTAAGAAGGCATACAGAAAATCTGCTATAAAGAATCATCCTGATAAGGGTGGGGACCCTGAAAAAGTGAGTTGTCCCTTCTCGCACGCGCTG
TTAGGATTTTCTGCATCTTGCGATTCTAGATATGTTACATCTATACCAAAGGAACCTTTTGATTCTGATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E358115] SGN-U583042 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T170675 [Download] [View] Facility Assigned ID: THTDN17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0158 Quality Trim Threshold: 14.5