EST details — SGN-E358783

Search information 
Request: 358783Match: SGN-E358783
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C102366Clone name: cLHT-24-K12
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194045 [TUS-69-M19] Trace: SGN-T347309 EST: SGN-E546434 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194045 [TUS-69-M19] Trace: SGN-T347310 EST: SGN-E546435 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E358783Length: 451 bp (841 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E358783 [] (trimmed) GCGGCAGGATGACACTCACAGGGACAAGCTAAAGGATACTTGTTTAACTAACATCATGAAACCTGTCAATCCAGAAGATGTGCACCCAGCAAAAA
TTATGCCAAAAGAAAACCAGGAAGAGACTGGAAGCCATAAACTTACAGGTCATCCTGTAAAAGTTGGTCCATCCGAGGCTAAATTTTGTGAGCCA
GTGCTGCAGGATGACATTCACAGGGAGAAGCTAAAGGACACTTGTACAACAAACATCATGAAACCTGACAATCCAGAAAATGTGCAACCAGCAAC
AAATGTGCCAAAAGAAAACCAGGAAGGGACTGGAAGTCATGAACTTACAGGTAGTAGTGGCCATCATTCTTTGGTGTCTGAAAATCACAATAATA
GCACTGGAAGTCATGGTCATTTGTGTCAGCCCAAGAGAAAAGAGATCCCGATAAATAACGATGATGAGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E358783] SGN-U576286 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T170343 [Download] [View] Facility Assigned ID: THTDP66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0106 Quality Trim Threshold: 14.5