EST details — SGN-E358930

Search information 
Request: 358930Match: SGN-E358930
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C102451Clone name: cLHT-24-O8
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194059 [TUS-69-N9] Trace: SGN-T347333 EST: SGN-E546458 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194059 [TUS-69-N9] Trace: SGN-T347334 EST: SGN-E546459 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E358930Length: 347 bp (970 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E358930 [] (trimmed) CCAGCAGGCCCGACTAAAACAGAGAATGACGCAGCAGTTTACGCGGTCTGGTTTTCCTCAGACACCCTGAAATGGCCTTGGTCAGCCTATTGAAA
ACAATCTTCGGAAAGAAGACCCATTCCAGAACAGGAAAATAGTGCAAAGTCCTCGTGTATCTGCAGGAGGCTTGCCTCAATCTCCTTTATCCTAT
GAGTCTGGAGGAGTTTAATAATGGTTCTGTAGGAGCTCAATATGGTGCAGCTGTGACTAGTGGACTTATACAATCAATGAAGGAGAAGCAAGGAT
CCACATCTGTTGCTCCAGCTGGTGGAACAACTTCTATGACTTCTAGCGCCAATGATTCCATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E358930] SGN-U564905 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T170490 [Download] [View] Facility Assigned ID: THTDP88TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0210 Quality Trim Threshold: 20.5