EST details — SGN-E358961

Search information 
Request: 358961Match: SGN-E358961
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C102385Clone name: cLHT-24-L1
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194047 [TUS-69-M21] Trace: SGN-T347312 EST: SGN-E546437 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194047 [TUS-69-M21] Trace: SGN-T347313 EST: SGN-E546438 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E358961Length: 609 bp (875 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E358961 [] (trimmed) TGATTTTACTGCATTTATAGGTCCTATTATGAATTTGATCGGGGATCATGTAGCGATTTGCAGTCCAATCGCTTTCCCGTTGCAGGAGGAAGGCA
CCAGTGAGGAGGAAAGCAAAAGATTTGAGATGTTGTATTACAGACAGCAGATTAAATGTTTGCATGATATTTACTTTGATTTGCTTGAGAAATTA
GAGCTATGTCTAAAGAAAATGGAAGAATCTTTAGCATTGAAAGAGAAAGGAGAAGGTGAGCCTCTTGTATCCGGGTGGTCCCAGTATTTTGCAAT
TCTGAAGGAGATAAATGCTATATCAAAACTTTATAAGGGCTCGGAGGATGAATTTTGGAATAGAATGAGGCATAGAAAAGTTTCATTGTGTTTTC
TGATTATGAGATTTGCAAAACGATCTGAAGATCATCGGTGGATTTTGGAGCACAAGGAGGTGACTAATTTTGAGGTGAGGAGGTATCTAGCCATG
ATGATGCTTCCAGAAGTGAAGGACGAGTACGAGGAGCTACACGAGATGCTCATTGACCGCGCTCAGTTGCTCTCAGAATCTTTTGAGTACATTGC
ACATGCAGATCCTGAGTCATTACGTGGTGGTTTGTTTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E358961] SGN-U582141 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T170521 [Download] [View] Facility Assigned ID: THTDQ61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0020 Quality Trim Threshold: 14.5