EST details — SGN-E359028

Search information 
Request: 359028Match: SGN-E359028
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C100938Clone name: cLHT-11-G23
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E359028Length: 562 bp (896 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E359028 [] (trimmed) GGGCACCCCATTAAGCACATCTTACACAAAAATATGGAATTTGATAATGCTATAATAGTTATTACAATACCAAATATTGCAAATTGTTTTGCATG
CACTCTTATATTATCTATACAAATTGTGAGAAATATACCACGCCTTTGTATGCCTAACCAAATCCAACTACCAAAAGGTTTCAACCTATAGTATT
TAAGGCTTTGAATGCAGTATAGCTCTGCATTAACCAAAAGTTCAATTCACATGTTAAAAGTACCAACATGCTAATGATCCTGTATGCACTGTCCA
AAAGAGAGAGGCTTTGGAATGAAATGATGAGCTGGGTAACATGTATATTGTCTCGTCCTATGTATACTTCATCACATCTCTTTGCCTCGTCCTAT
GTGAACCCTCATCGCGTTTTTTTGGCAGACTTTGGGTTTTTCAACATCCGGATACTTGATGGAGTAACTTCAACAAGCTCATCTTCTTGAATGTA
CTCTATGCAATCATCCAGACTAAAATCTAGTGGGGTATCAAGAACCACTGTTACTTCTTTGTTTGAACGGACATTTGTTGCAGCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E359028] SGN-U576318 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T171230 [Download] [View] Facility Assigned ID: THTBO48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5