Notice: SGN will be briefly unavailable for maintenance. Apologies.

EST details — SGN-E359147

Search information 
Request: 359147Match: SGN-E359147
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C100871Clone name: cLHT-11-C19
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193735 [TUS-68-P21] Trace: SGN-T346777 EST: SGN-E545902 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193735 [TUS-68-P21] Trace: SGN-T350158 EST: SGN-E549283 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E359147Length: 516 bp (901 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E359147 [] (trimmed) ATTACCAAGGCAAAAATATCTTGGGCCTTCTAAACTTTCTCCTCTGTGCTGTGCTGACGCATTTTGTTGAAACTTGAATTCTTGCTTTGCTCTAT
TCTTCCTTCTTGTTTGTTGCTGAAATTTATCAGCTGAGTTCTTCTTTCTTGAGAGAATTGGGGAATTATCAATTCTTGGAAAATTAGAGAAAGCT
GGAGTCTTGCTGCTAATTTACCTACAGCATATACTAGGCGATGTTTTCACCTTCAATTTGCTTTCCAACAACAATTCTTCAAATTCAGCCAGATA
ACACAAGTCGCTTCAGAACCCACAAATGTAAAAGCTATACTGATGACAGAAAACTTCCCTGTTTCTCTTTCAAAGACCCATCTTCCTCAGCTCGT
TTTGATGTTTCTGCAAGTTTTTGTAGAGACAATGAATTAGTTTGTCAATTGGAAGTTCCAGGTGATAAAATTTGTTCAGTGAATACTTTTGTGGC
TGATTCAAGTTTGCTTGGTCGTTTGCTTCAATCTAGTTCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E359147] SGN-U572642 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T171349 [Download] [View] Facility Assigned ID: THTBO22TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5