EST details — SGN-E359835

Search information 
Request: 359835Match: SGN-E359835
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C108519Clone name: cLPP-9-E22
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194504 [TUS-70-P22] Trace: SGN-T348098 EST: SGN-E547223 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C194504 [TUS-70-P22] Trace: SGN-T350375 EST: SGN-E549500 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E359835Length: 184 bp (841 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E359835 [] (trimmed) CCTCTCGGACCTCATCATCATCGTTTGTGTCTATTCCTCTGTTTGTTCATCAATTCCCTGATTGCTTACCCACTATTCGATCTTCATTTTGATCT
GAAACCTCAAGGTACTGGAGATTCTATGCACATATATTGATACTGTGTGGGTGCTGTTTTCATCATTGAAGGACTGATATTGCAATTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E359835] SGN-U570622 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T172498 [Download] [View] Facility Assigned ID: TPOBH35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.909 Expected Error Rate: 0.0271 Quality Trim Threshold: 14.5