Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E359894

Search information 
Request: 359894Match: SGN-E359894
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C108493Clone name: cLPP-9-D12
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194499 [TUS-70-P17] Trace: SGN-T348089 EST: SGN-E547214 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194499 [TUS-70-P17] Trace: SGN-T348090 EST: SGN-E547215 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E359894Length: 494 bp (920 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E359894 [] (trimmed) TCTCAAGTCAAATCCTCCATTGAAGAAACTTTAAGCTCCAAGGAAGAGGATCAAATTCCCCATGTTTTAACCTAAATTTCGTGGATAGGTCTTCA
ATGAGGTGGTGGCAACTGAGGATTCCTAGAGTTGAAGCTTGGGAAGTAGATTTCTCTCAAGATTGGATATGAGTCGAAGGAGGACACCTGCATGA
AGTGTGAAGAAAGGAGTAGTGAATGAGGGATTTCCTTCCCTAGACAAATAAGTTCCTCAAGATGAAAAAATGCCTACAGCTAGTTAAGCGAATGA
GGTTCTGGTAGTTCCCCTGGAGATGACTAAAGAGGAGGTTAAAAGAGCTCTTATTGCCCTATACCGAGCCACTTAAGAATATAGTGAAGTGGGGC
CTAGGGTGAATTCTCTTGAGAGTACCATGACTTCTAGGTTGAGGTACTTTGTTCAAAGGTGGGATAGGATCCCCAAGAGTTTCTAGATTGTGTTT
ATAAAGTGTTGAATGCTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E359894] SGN-U564862 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T172557 [Download] [View] Facility Assigned ID: TPOBJ18TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0119 Quality Trim Threshold: 14.5