Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E360515

Search information 
Request: 360515Match: SGN-E360515
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C108203Clone name: cLPP-8-D1
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E360515Length: 484 bp (992 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E360515 [] (trimmed) TTTCTTTCTCTTTCATTTTCATATTTCTCCGATCTCGGGTTGGAGTTTCCCTTCATCATTTTCTGAGAAATAATTTCTAATGGCCGCTCCACCCG
CTAGAGCTCGAGCTGATTACGATTACCTCATCAAACTCCTTTTGATCGGCGACAGCGGTGTGGGTAAGAGTTGCCTTCTTTTACGTTTCTCAGAT
GGCTCCTTTACGACCAGTTTTATCACAACTATTGGTATTGACTTCAAGATAAGGACCATAGAGCTTGACAGTAAACGCATCAAATTGCAAATCTG
GGATACTGCTGGTCAGGAGCGGTTCCGAACAATTACAACTGCTTACTACCGTGGAGCCATGGGTATATTGCTGGTGTACGATGTAACTGATGAGT
CATCTTTTAACAACATCAGGAACTGGATAAGAAACATTAACAGCATGCTTCCGACAATGTCAACAAAATACTGGTCGGCAACAAGGCTGACATGG
ATGAAAGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E360515] SGN-U578937 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T172391 [Download] [View] Facility Assigned ID: TPOBE13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0085 Quality Trim Threshold: 14.5