EST details — SGN-E360708

Search information 
Request: 360708Match: SGN-E360708
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C108056Clone name: cLPP-7-L18
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194447 [TUS-70-N13] Trace: SGN-T348000 EST: SGN-E547125 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C194447 [TUS-70-N13] Trace: SGN-T350359 EST: SGN-E549484 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E360708Length: 513 bp (904 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E360708 [] (trimmed) TTCTTCTTTATACTGATATTCAGATCTCTCTCTTTTACGATTCTTCGCATCAGCCATGGGTATCTGGGAAGCTTTTCTCAATTGGCTTCGAAGCC
TCTTCTTTAAGCAGGAAATGGAGCTTTCATTGATAGGATTGCAAAATGCAGGAAAAACATCTCTTGTAAATGTTATTGCAACTGGTGGATACAGT
GAAGACATGATACCAACTGTGGGATTTAACATGCGCAAAGTGACGAAAGGAAATGTCACTATAAAATTGTGGGACCTTGGAGGTCAACCCAGATT
CCGCAGTATGTGGGAGAGATACTGTCGTGCTGTTTCTGCTATAGTTTATGTTGTTGATGCTGCTGATCCTGATAACCTCAGCATATCAAGTAGTG
AACTCCATGACCTGCTGAGCAAGCCATCTCTGAGTGGTATTCCATTGCTGGTGCTGGGAAACAAAATTGACAAGCCTGATTCCCTGTCCAAACAG
GCTTTGACTGACCAGATGGGATTGAAATCAATAACTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E360708] SGN-U571254 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T173111 [Download] [View] Facility Assigned ID: TPOBB69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5