EST details — SGN-E360726

Search information 
Request: 360726Match: SGN-E360726
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C107893Clone name: cLPP-7-C7
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E360726Length: 340 bp (852 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E360726 [] (trimmed) TTAAAGACATTTGCAAAGCGTACAAGCATCTTGTTAAGAAATGGCATCCTGATAGAAATAAATCCAATCAAGCTGAAGCTGTAGACAAGTTTCGA
TCCATCAATGAAGCCTATAGAGTTCTTAGCAAGAAAAAGAGAGAGGAAGCAGATTTATTTAAGAGCGATACGGCAAAAACACCTAAAAAAAGTTC
AAAAGATGAGGAGGATGAGTTACAAATTTCAAGTCCTACACTTCTTTCAAGAACAACAAGTCGAATCAGCCCAACAGTAGATTTTTACACGTCGA
TGCCAGCATGTTTTACCATGAGTGGAACCAACACTCCCACAACCCCTGGCACCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E360726] SGN-U577027 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T173129 [Download] [View] Facility Assigned ID: TPOAY16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0041 Quality Trim Threshold: 14.5