EST details — SGN-E360749

Search information 
Request: 360749Match: SGN-E360749
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C108004Clone name: cLPP-7-I23
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194437 [TUS-70-N3] Trace: SGN-T347983 EST: SGN-E547108 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E360749Length: 453 bp (931 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E360749 [] (trimmed) TTAATTTGGGAGATAAATTTTGATTTTGGGTAAAAGGGTAGAAATTATTTAGATGGGTAATACCGGAAGTAATGGTATGAATGGCCGGAGAAGAA
ATTACAGCCACCGGCGGAGCCACCTGCCACAACCGGAGATCACCGGTAACAGTTACGTATTTGCCGCAGCATCGCCACCATATTCTTATCAGCAA
AATCCTAATACGACACCGTATTATCAGTACCCGGGTTATTATCCGCCGCCGTATGAACAGCATTCCCACCACCATATGAACCCTAATTATGCAAA
TTGGGTTAATGGCGGTTACCCGTGTGAACCACCCATGATACCTCCAACGCCTGCACCTTATGTGGAGCATCAAAAAGCTGTGACGATACGTAATG
ATGTGAATCTGAAGAAGGAGACTCTAAGGATTGAGGCGGATGAAGCTAATCCTGGAAAATACCTCGTCGCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E360749] SGN-U565056 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T173152 [Download] [View] Facility Assigned ID: TPOAY60TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0115 Quality Trim Threshold: 14.5