Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E360773

Search information 
Request: 360773Match: SGN-E360773
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C107922Clone name: cLPP-7-E12
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194425 [TUS-70-M15] Trace: SGN-T347962 EST: SGN-E547087 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194425 [TUS-70-M15] Trace: SGN-T347963 EST: SGN-E547088 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E360773Length: 360 bp (895 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E360773 [] (trimmed) TTTGGAAAGGTGTACAAAGGAGTTATCGATGGTGACACGAAAGTTGCAATCAAAAGATCAAATCCATCTTCAGAACAAGGAGTCAATGAATTCCA
GACTGAAATTGAGATGCTCTCAAAGCTAAGGCATCGACATTTAGTGTCCTTGATCGGATTTTGTGAAGAGAACAATGAAATGGTCCTTGTTTATG
ACCACATGGCACATGGAACATTAAGGGAGCATCTTTACAAAGGTAACAAAACTATACTATCTTGGAAGCAAAGGTTGGAGATTTGTATTGGATCA
GCCACAGGACTTCATTACCTTCACACAGGAGCTAAATACACTATTATACATAGAGATGTGAAAAGTACAAACATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E360773] SGN-U582769 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T173176 [Download] [View] Facility Assigned ID: TPOAZ30TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0065 Quality Trim Threshold: 14.5