EST details — SGN-E361263

Search information 
Request: 361263Match: SGN-E361263
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C104741Clone name: cLPP-15-L17
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194705 [TUS-71-I7] Trace: SGN-T348443 EST: SGN-E547568 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194705 [TUS-71-I7] Trace: SGN-T350432 EST: SGN-E549557 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E361263Length: 311 bp (809 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E361263 [] (trimmed) GCTTCTTTCATTTTGCTGAATGGGGTCCGATTGAATAACAAAGTTGAACCCGGGTGGATGCCCGAATAGCGTTTTCCTCTTTTTAAGGTTCTTGA
ATCAAATTGTTCGATTGTGCTGTATATTAGTGTACTCCACTGGGACGTATTTTCTGTTGTTTTGGATGTCTGTGATGATGCATTCTGTTGATGAA
GTTACAGAAATGGGGTGCTGTGGATGTTTTGGATTCTCTTTTGCAAGAAAACCAAAAAAGGAAATTAGGCCTTATAGGGGATATGGAAACAGCTG
GTCACATGAACCATTGTTTCAACAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E361263] SGN-U569102 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T176239 [Download] [View] Facility Assigned ID: TPOCG69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0143 Quality Trim Threshold: 14.5