EST details — SGN-E361691

Search information 
Request: 361691Match: SGN-E361691
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C103949Clone name: cLPP-12-H21
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194609 [TUS-71-E7] Trace: SGN-T348278 EST: SGN-E547403 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194609 [TUS-71-E7] Trace: SGN-T348279 EST: SGN-E547404 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E361691Length: 328 bp (888 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E361691 [] (trimmed) TTCATTGAATGTACTGTAATCGGTCAATATTCCGATTACAGTTCATTGAATGTACTGTAATCGGAATATTGACCGAGGATTTTTGTGATATTAAA
GGCTGAGGCAGAGGACGCGAACAAGATTAAGAATGAACATAGCAAATGGTGCAGTTGGTGATCTCACATCGAAATCAGATGATGTTCTTAAGAGA
GTGTTGGCTACACACGTCGTATTGGATTACTACGATCCAATGAAACTTCAGAAGATGAAGGACAAAACAGCGAAAATGACAACAATGTTTCAACA
ATCTGGTAAAGCAGCGTATGATCAAGGTTTCCTAAATGTTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E361691] SGN-U583300 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T174890 [Download] [View] Facility Assigned ID: TPOBU47TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5