EST details — SGN-E361765

Search information 
Request: 361765Match: SGN-E361765
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C103897Clone name: cLPP-12-E3
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194599 [TUS-71-D21] Trace: SGN-T348261 EST: SGN-E547386 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194599 [TUS-71-D21] Trace: SGN-T350402 EST: SGN-E549527 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E361765Length: 386 bp (721 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E361765 [] (trimmed) ATTTTCTTCTTCATCCAATTTCCGGAGCCTTTTTCTAAATTCATATCAAGTTTGTAAGGTTTTTGGGAATGGATGAGGTCAAGAAATCAGAGGGT
CATATGACATCCCCTGCAGCTTTTGTGGAAGGAGGAATTCANGATGCATGTGATGATGCTTGCAGCATTTGTCTCGAGGCTTTCTGCGAAAGCGA
TCCTCCCTCGGTAACTAGCTGCAAGCATGAATTTCATCTCCAGTGCGTCCTGGAATGGTGTCAGAGAAGTTCTAATTGTCCTATGTGTTGGCAGT
CCATAAGTCTGAAAGATCAGATGAGTCAAGAATTGTTTGAGGCTGTGGAACAAGAAAGGAATTTTAGAGTTAATGCAGAAAGAAATGCTACAGTA
TTTCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E361765] SGN-U583318 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T174964 [Download] [View] Facility Assigned ID: TPOBS26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0342 Quality Trim Threshold: 14.5