EST details — SGN-E362061
Search information |
Request: 362061 | Match: SGN-E362061 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C103806 | Clone name: cLPP-11-P24 |
| ||
Library Name: cLPP | Organism: Solanum pennellii (formerly Lycopersicon pennellii) |
Tissue: pollen
Development Stage: pollen collected from open flowers
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E362061 | Length: 206 bp (728 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E362061 [] (trimmed)
ATCTTTCATCGATCTTTCTTCGTTTTCTCGGCGAAATTTAGGGTTTGAATCTCGCTGTACGATCGCTATTCCGAAGTGAACTCTATATGCACGGC
ACCAATGAAGACAGGAACATCAACTTTGAACCCCTATGCAGACGCATATGTGCCTATTTCGAAAAGAGGGGCACCTGATGGAAACAAAGAAGCTA
GATCTCCAAATGAGTT
ACCAATGAAGACAGGAACATCAACTTTGAACCCCTATGCAGACGCATATGTGCCTATTTCGAAAAGAGGGGCACCTGATGGAAACAAAGAAGCTA
GATCTCCAAATGAGTT
Unigenes |
Current Unigene builds | |||||
[SGN-E362061] | SGN-U581037 | Tomato 200607 | Build 2 | 14 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T174104 [Download] [View] | Facility Assigned ID: TPOBR96TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.969 | Expected Error Rate: 0.0121 | Quality Trim Threshold: 14.5 |