EST details — SGN-E362304

Search information 
Request: 362304Match: SGN-E362304
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C103321Clone name: cLPP-10-D10
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E362304Length: 603 bp (899 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E362304 [] (trimmed - flagged) CTCTCTCTCCATAGCTCCTCCTGTTCTAATGTCCTTCATTCTCCCACCAAAAAAAAGAAGAAAATAATCATCTTCCATGGGAGAATCTACGAAAT
CACCATCGTCTGCGTCAAAATATTATGGAATATTAGAAATTCCAAAATCAGCATCCCTTAAAGACATTTGCAAAGCGTACAAGCATCTTGTTAAG
AAATGGCATCCTGATAGAAATAAATCCAATCAAGCTGAAGCTGTAGACAAGTTTCGATCCATCAATGAAGCCTATAGAGTTCTTAGCAAGAAAAA
GAGAGAGGAAGCAGATTTATTTAAGAGCGATACGGCAAAAACACCTAAAAAAAGTTCAAAAGATGAGGAGGATGAGTTACAAATTTCAAGTCCTA
CACTTCTTTCAAGAACAACAAGTCGAATCAGCCCAACAGTAGATTTTTACACGTCGATGCCAGCATGTTTTACCATGAGTGGAACCAACACTCCC
ACAACCCCTGGCACCCCTGTATCAGATCAACCTCCAAATAACCTTTCCAAAGTTGCTAGTAAGCCTATCATTTTTTCTCAATCTACTTCTCGGAG
AAAAACTCAACCAATTGAGAAGAAATTGGAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T176060 [Download] [View] Facility Assigned ID: TPOBN17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Problems: Possibly chimeric, detected by unigene assembly preclustering
Sequence Entropy: 0.943 Expected Error Rate: 0.0055 Quality Trim Threshold: 14.5