EST details — SGN-E362324

Search information 
Request: 362324Match: SGN-E362324
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C103427Clone name: cLPP-10-L16
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
See unigene SGN-U564802 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E362324Length: 429 bp (1083 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E362324 [] (trimmed) AACAATCCCTGTTTTTTCCTTTTCTCCCAAACCCTAACTCTCTCCTTCATCAAGAATCTTCCAATCAAATCTCTATCTTTGATTTTCTATCTTTT
TCATATTTTTTTTGGTTACAGATTTCATTACATTTTCTTCAATCAGATTTCTGATTGATGAATCTTTCAAATCTGGTTGAGATTTGGATGTTTGT
TTCATTTGGATGATTTAAACGATGATTGCAGATCCGAATTTGGTTTACTACTCTTGTGTTGCCAAAGGAACAACTATCCTTGCTGAGATCAATTC
AAAAGATGCCGATCTTGGATCCCTAGCTTTGAAATGCCTTGAAAAGACTCCTCCTTTGCATGCCTTCTTCTCTCATACTATCCGAAACAGGACAT
ACACGTTCCTGATTGAAAACCCATATGTGTTTTTCGCCATATTCGATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E362324] SGN-U564802 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T176080 [Download] [View] Facility Assigned ID: TPOBN68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.928 Expected Error Rate: 0.0065 Quality Trim Threshold: 14.5