EST details — SGN-E362473

Search information 
Request: 362473Match: SGN-E362473
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C106074Clone name: cLPP-1-L7
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
See unigene SGN-U564802 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E362473Length: 614 bp (930 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E362473 [] (trimmed) TTCTCTCTCCATCTCTCTCTCTCCATGGCCGAGAGAACAATCCCTGTTTTTTCCTTTTCTCCCAAACCCTAACTCTCTCCTTCATCAAGAATCTT
CCAATCAAATCTCTATCTTTGATTTTCTATCTTTTTCATATTTTTTTTGGTTACAGATTTCATTACATTTTCTTCAATCAGATTTCTGATTGATG
AATCTTTCAAATCTGGTTGAGATTTGGATGTTTGTTTCATTTGGATGATTTAAACGATGATTGCAGATCCGAATTTGGTTTACTACTCTTGTGTT
GCCAAAGGAACAACTATCCTTGCTGAGATCAATTCAAAAGATGCCGATCTTGGATCCCTAGCTTTGAAATGCCTTGAAAAGACTCCTCCTTTGCA
TGCCTTCTTCTCTCATACTATCCGAAACAGGACATACACGTTCCTGATTGAAAACCCATATGTGTTTTTCGCCATATTCGATGAAAAAATTGACA
AATCAGATGGTCTTGCGTTTCTCAAAGGGGTTGAAGAGGCGTTTCGTGGAGTAATTGAGAGATCTTCTGGGAAGAAGCGTTTGGATAAATTGAAT
TCGCATTGTTTTCAGGGAGAGTTGAATCCTGTTTTTCATCAGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E362473] SGN-U564802 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T174534 [Download] [View] Facility Assigned ID: TPOAC64TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0060 Quality Trim Threshold: 14.5