EST details — SGN-E362554

Search information 
Request: 362554Match: SGN-E362554
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C105913Clone name: cLPP-1-E12
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194220 [TUS-70-E2] Trace: SGN-T347610 EST: SGN-E546735 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C194220 [TUS-70-E2] Trace: SGN-T350295 EST: SGN-E549420 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E362554Length: 539 bp (931 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E362554 [] (trimmed) GAAGATGATATAATTAAGAAGCAACCTAGCGCATACACCCCTGTTGTTGACAAAGTAATTGAACCAACTATTCCTAAAGCTACAAAAGCGGACAA
CTACGCCATTGCTAAAGCTTCAGATTTCTTACCCATGCATGATATTTCTAAATCCCCCGATGGATTTAGCAACCACCTTTTCACAGGAGTGATGA
CATTTGTGATGGGTGTGGTGACAATGGTGCGAATGACACGCAACATGCCAAGAAAGCTTACAGATTCGACTCTCTTGTCAGGTTCATTAAAAGGA
GTTGATATGCAAGTTAAACCAGTACACGGTCAAGAATATCGGTTGAGTGGACCTGCCATCTCAAATAATGAGTACTTCAGCATGATGAAACGTAT
GGGAGAGCTAGAGGAGAAGGTTATTAGTCTTAGCAACACGCCTAGTTCCTTACCACCCGAAAAAGAGGAAATGCTTAACAATGTCATGACTCATG
TTGATAAATTGGAGCAAGAACTTTGTGCAACAAAAATGGCACTTGAGACAGCCCTTTCCCGTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E362554] SGN-U570233 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T174615 [Download] [View] Facility Assigned ID: TPOAB30TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0015 Quality Trim Threshold: 14.5