Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E362713

Search information 
Request: 362713Match: SGN-E362713
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C105972Clone name: cLPP-1-H1
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194231 [TUS-70-E13] Trace: SGN-T347629 EST: SGN-E546754 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E362713Length: 597 bp (948 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E362713 [] (trimmed) TTCTAACTGCCGATATTTTTCACTAGCTGAGATCAAACAGGCCACTAAGAACTTCGACGAATCATATGTCATTGGAGTTGGTGGATTTGGAAAAG
TGTACAAAGGAGTTATTGATGGTGACACGAAAGTTGCAATAAAAAGATCAAACCCATCTTCACAACAAGGGGTTAACGAATTTCAAACTGAAATT
GAGTTGCTTTCAATGCTAAGGCATAGACATTTAGTGTCCCTAATCGGATTTTGTGAAGAGAATAATGAAATGGTCCTTGTCTATGACCACATGGC
ATACGGAACATTAAGAGAACATCTTTATAAAGGTAATAAAACTGTACTATCTTGGAAGCAAAGGTTGGAGATTTGTATTGGAGCAGCTAGAGGAC
TTCATTACCTTCATACAGGATCTAAATACACCATCATTCATAGGGATGTGAAAAGTACAAACATTTTGTTAAATGACAAGTGGGTTGCTAAGGTA
TCAGATTTTGGACTTTCAAAAACAGGTCCAAACATGAACCAGGGACATGTTTCAACAGTCGTAAAGGGTAGCTTTGGTTATTTGGATCCCGAATA
CTTCAGAAGACAACAATTGACTGAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E362713] SGN-U582770 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T174774 [Download] [View] Facility Assigned ID: TPOAC37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0097 Quality Trim Threshold: 14.5