EST details — SGN-E362860

Search information 
Request: 362860Match: SGN-E362860
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C106694Clone name: cLPP-2-P15
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180259 [TUS-33-O9] Trace: SGN-T186437 EST: SGN-E373985 Direction: 3' Facility: INRA
Clone: SGN-C180259 [TUS-33-O9] Trace: SGN-T186438 EST: SGN-E373986 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E362860Length: 615 bp (910 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E362860 [] (trimmed) TAAAGTGACAGTTGTGGCTTTGCTACTTTGCCTTTCAGTAGGGGTAATAGCTGAGGACCCTTACCTCTACTTTAACTGGAACGTTACCTATGGCA
CAGTCTCTCCATTGGGCGTGCCACAACAAGGTATTCTCATCAATGGCCAGTTCCCTGGGCCTAGAATTAATTGTACCTCCAACAACAATATTGTC
GTCAATGTCTTCAATAATTTGGATGAGCCATTCCTATTCACCTGGAATGGTGTCCAACATAGGAAGAACTCATGGCAAGATGGTACCCCAGGAAC
CATGTGCCCAATCATGCCTGGTCAAAATTTTACCTACCGATTCCAGGTCAAGGACCAGATTGGTAGCTACTACTACTTCCCTACCACAGCTTTGC
ACCGAGCAGCAGGTGGTTATGGTGCCATCAATGTCCACAGTCGTGCTCTCATCCCTGTTCCTTTTGACAATCCTGCCGATGAGTACAATGTCTTT
GTCGGTGATTGGTACAACAAGGGCCACAAGACTTTGAAAAAGGTCTTAGATGGTGGACACACCGTTGGCAGACCTGATGGCATCATCATCAATGG
TAAGTCTGCTAAGGTTGGAGAGGCAAAAGAGCCACTCTTTACCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E362860] SGN-U578153 Tomato 200607 Build 2 112 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T173720 [Download] [View] Facility Assigned ID: TPOAG92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5