EST details — SGN-E362887

Search information 
Request: 362887Match: SGN-E362887
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C106573Clone name: cLPP-2-J4
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180215 [TUS-33-M13] Trace: SGN-T1611 EST: SGN-E378573 Direction: 5' Facility: Giov. Lab
Clone: SGN-C180215 [TUS-33-M13] Trace: SGN-T186515 EST: SGN-E374063 Direction: 3' Facility: INRA
Clone: SGN-C180215 [TUS-33-M13] Trace: SGN-T186516 EST: SGN-E374064 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E362887Length: 599 bp (901 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E362887 [] (trimmed) GCAAATAATTTTTTAAATCTAGTGCTCTGGCACTAGATATAAAAATACGCCATTAAAACTCCTTGTCTTTTATTTCTATAGCTCTCTTCCTCAAA
AAATCCTATAAAACTCTCAAAATTCCGAAGCACCAATTTCAATATAAATATTAGGTCATGGATAATAACATGCAACAAGCTGCTGTGATGAATAA
TAACATTCAACAACCTCCTGTTAGTCTCCCAACCCCTCAAGGTTATCCTCCACAAGCTTACCCAAATGGGATGTATCCTCCCCCACAAGTATATA
CTCCCCAGGCCCAAGGGCATGGATACCCACAAGGAGTAGGATATTACCCTCCTCACCCCCAACCCCAAGGTTATCCTCCGCCCATCGGAATGGGA
TATCCACCACAAGGTTACCCTCCACAAAGTTGTCATCCTCCACAATATGGTGCACCCCCACAAGGGCAAGGATATCCTCCTCAAAAACAAAAACA
AAATCAAGCTGCTACTGGTGTCATGGGAGGATGTTTGGCTGCTTTGTGTTGCTGTTGTCTCTTAGATGCATGTCTTGAATGAAGGATCAATGATT
TATTTTTTTTAACCGCAAGTGATCTACAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E362887] SGN-U565098 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T173747 [Download] [View] Facility Assigned ID: TPOAH50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0008 Quality Trim Threshold: 14.5