Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E362947

Search information 
Request: 362947Match: SGN-E362947
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C106675Clone name: cLPP-2-O19
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180249 [TUS-33-N23] Trace: SGN-T186854 EST: SGN-E374240 Direction: 3' Facility: INRA
Clone: SGN-C180249 [TUS-33-N23] Trace: SGN-T186855 EST: SGN-E374241 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E362947Length: 492 bp (992 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E362947 [] (trimmed) AAAGATTAAAAAAAAAAAATACTCAAAAAGAGAAAGTGGTACATTTGTTTTTCAATTTATATGTAGAAAAAAAAAAGCATCATTAGCAAATAAAT
AACATTAATTAAAAGAGGAAAAAATGGGGGCATATAGGGCTGATGAAGATTATGATTATTTGTTTAAAGTTGTTCTTATAGGTGATTCTGGTGTT
GGCAAATCAAATTTGCTTTCTCGTTTTACAAAAAATGAATTTAGCCAAGAATCTAAATCTACAATTGGTGTTGAATTTGCTACAAGAACAATTCA
TGTTGATGATAAGATTATCAAAGCTCAGATTTGGGATACTGCTGGTCAAGAAAGGTATCGAGCCATCACTAGTGCATATTATCGAGGAGCAGTGG
GTGCCTTACTTGTTTATGACATTACTCGTCATGTAACGTTTGAAAATGTAGCAAGATGGCTCAAAGAACTCANAGACCACACAGACCAAAACATC
GTCGTCATGCTCGTCGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E362947] SGN-U584956 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T173807 [Download] [View] Facility Assigned ID: TPOAE94TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0052 Quality Trim Threshold: 14.5