EST details — SGN-E362964

Search information 
Request: 362964Match: SGN-E362964
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C106463Clone name: cLPP-2-E20
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180185 [TUS-33-L7] Trace: SGN-T186838 EST: SGN-E374224 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E362964Length: 666 bp (905 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E362964 [] (trimmed) TGAACCCATTAATTAACATTATCGTCATTTGGTTCACGTGAAAAAAACCAAGCCCACAATATCTAAAATATGTATATATATTAGCTACTTTAAGC
TTCAATGACATTTTAGTTCTTGTATCACATCTCTATTTTTGTGTTCTAAAACATAATGACAACAACAAGTGTTCTTTCTAGTGGATTCAACCACT
CAACCCTCCCTCAGTCTTACGTTCGACCTGAATCTCAAAGACCTTGCATGTCTGAAGTTGTTGATAGCGACGATCTTGTCCCAGTCATTGATATG
TCTTGTACTAATAGGAACGTTATCGTTCATCAAATCGGTGAAGCTTGTCGTCTTTATGGGTTTTTCCAGGTGATAAATCACGGTGTGTCGAAGAA
GGTGATAGATGAAATGTTAGGGGTAAGTCATGAATTTTTTAAGCTACCAGTTGAAGAAAAGATGAAATTGTATTCTGATGATCCATCAAAAACTA
TGAGATTATCAACTAGTTTTAATGTTAAGAAGGAAGCTGTTCATAATTGGAGAGATTATCTTAGGCTACATTGTTATCCTTTGGACAAATATGCC
CCTGAATGGCCTTCTAATCCTCCTTCTTTCAGGGAAATAGTAAGCAAATATTGCATGGAAGTTAGAGAGCTTGGATATAGATTGGAAGAAGCAAT
A
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E362964] SGN-U576121 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T173824 [Download] [View] Facility Assigned ID: TPOAF34TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0061 Quality Trim Threshold: 14.5