EST details — SGN-E363299
Search information |
Request: 363299 | Match: SGN-E363299 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C107253 | Clone name: cLPP-4-M16 |
| ||
Library Name: cLPP | Organism: Solanum pennellii (formerly Lycopersicon pennellii) |
Tissue: pollen
Development Stage: pollen collected from open flowers
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E363299 | Length: 155 bp (858 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E363299 [] (trimmed)
GATGGGGATGATGATTTCTACTCTACAAGAGGATTATCCGATGATTATACTCAGGTTTCGATGAACATTTAGAGAGTGTTGGTTATACATATTCA
TAGTTCGTGTGTAACACTTTTTTATTTGTTCAAATATCATCATGGTAAAAAAAAAAAAAA
TAGTTCGTGTGTAACACTTTTTTATTTGTTCAAATATCATCATGGTAAAAAAAAAAAAAA
Unigenes |
Current Unigene builds | |||||
[SGN-E363299] | SGN-U562637 | Tomato 200607 | Build 2 | 12 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T175736 [Download] [View] | Facility Assigned ID: TPOAN80TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.885 | Expected Error Rate: 0.0003 | Quality Trim Threshold: 12.5 |