EST details — SGN-E363299

Search information 
Request: 363299Match: SGN-E363299
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C107253Clone name: cLPP-4-M16
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E363299Length: 155 bp (858 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E363299 [] (trimmed) GATGGGGATGATGATTTCTACTCTACAAGAGGATTATCCGATGATTATACTCAGGTTTCGATGAACATTTAGAGAGTGTTGGTTATACATATTCA
TAGTTCGTGTGTAACACTTTTTTATTTGTTCAAATATCATCATGGTAAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E363299] SGN-U562637 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T175736 [Download] [View] Facility Assigned ID: TPOAN80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.885 Expected Error Rate: 0.0003 Quality Trim Threshold: 12.5