EST details — SGN-E363427

Search information 
Request: 363427Match: SGN-E363427
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C107061Clone name: cLPP-4-C24
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E363427Length: 381 bp (1199 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E363427 [] (trimmed) GAAGAAGAAGCCTCACCGGCTCTTCTTGAGAGAGTAAAAATATATAAAACTCCCAAAAAAAATTACTAGAGTCATCAAAAATAGAAAAAAAAAAA
AGAAACATCGTCATGGAGAGTGGTAAAGTGACAGTCGTGGCTTTGCTACTTTGCCTTTCAGTAGGGGTAATAGCTGAGGACCCTTACCTCTACTT
TAACTGGAACGTTACCTATGGCACAGTCTCTCCATTGGGCGTGCCACAACAAGGTATTCTCATCAATGGCCAGTTCCCTGGGCCTAGAATTAATT
GTACCTCCAACAACAATATTGTCGTCAATGTCTTCAATAATTTGGATGAGCCATTCCTATTCACCTGGAATGGTGTCCAACATAAGAAGAACTCA
T
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E363427] SGN-U578153 Tomato 200607 Build 2 112 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T175864 [Download] [View] Facility Assigned ID: TPOAN24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0134 Quality Trim Threshold: 14.5