Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E363610

Search information 
Request: 363610Match: SGN-E363610
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C106871Clone name: cLPP-3-I20
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194296 [TUS-70-H6] Trace: SGN-T347740 EST: SGN-E546865 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194296 [TUS-70-H6] Trace: SGN-T347741 EST: SGN-E546866 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E363610Length: 588 bp (894 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E363610 [] (trimmed) TTTTCTGAGAAATAATTTCTAATGGCCGCTCCACCCGCTAGAGCTCGAGCTGATTACGATTACCTCATCAAACTCCTTTTGATCGGCGACAGCGG
TGTGGGTAAGAGTTGCCTTCTTTTACGTTTCTCAGATGGCTCCTTTACGACCAGTTTTATCACAACTATTGGTATTGACTTCAAGATAAGGACCA
TAGAGCTTGACAGTAAACGCATCAAATTGCAAATCTGGGATACTGCTGGTCAGGAGCGGTTCCGAACAATTACAACTGCTTACTACCGTGGAGCC
ATGGGTATATTGCTGGTGTACGATGTAACTGATGAGTCATCTTTTAACAACATCAGGAACTGGATAAGAAACATTGAACAGCATGCTTCCGACAA
TGTCAACAAAATACTGGTCGGCAACAAGGCTGACATGGATGAAAGCAAAAGGGCTGTTCCTACATCCAAGGGTCAAGCACTTGCTGATGAATATG
GCATTAAATTCTTTGAAACTAGTGCCAAGACAAATATGAATGTTGAGGAGGTTTTCTTTTCCATAGCTCGGGATATAAAACAAAAGCTTGCCGAA
TCTGACTCAAAGGCTGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E363610] SGN-U578937 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T175441 [Download] [View] Facility Assigned ID: TPOAJ58TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5