EST details — SGN-E363821

Search information 
Request: 363821Match: SGN-E363821
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C106818Clone name: cLPP-3-F22
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E363821Length: 592 bp (966 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E363821 [] (trimmed) TACTTTGGAGCTACCGATAAGGTCTTCAAGTATGATCTCATGGCTGACGAACCATCAACACCAGACGACAAGGTAACCATTGCCTCAAATATCAA
GAATGCAACATTCCGTAACTTTGTTGAGATCATCTTTGAGAACCATGAGAAGACCATCCAAACCTATCACTTGGATGGTTATTCCTTCTTCGCTG
TTGCTGTTGAGCCAGGCAAGTGGACTCCCGAGAAAAGAAAGAACTACAACTTAGTCGATGCCATCAACAGACACAGCATCCAAGTCTACCCTAAC
TCATGGGCTGCCGTTATGACCACACTTGACAATGCAGGACTATGGAGCTTGAGATCAGAAATGTGGGAGAGGTTCTACTTGGGACAACAACTATA
CTTCAGTGTTCTCTCACCAGCTCGCTCGTTGAGAGATGAGTACAACCTCCCTGACAACCACCCTCTTTGCGGTATTGTTAAGACTATGCCAATGC
CTTCTCCATACAAGGCATAGATCGTCATACATTCGAAGGGGATCATAACATAAACAACAACACCATACCTTGATTTTTTCCCCTTTCTCAAATCA
TGTATTCTTTTCATTTACATTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E363821] SGN-U577364 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T175652 [Download] [View] Facility Assigned ID: TPOAL35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0198 Quality Trim Threshold: 12.5