EST details — SGN-E363888

Search information 
Request: 363888Match: SGN-E363888
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C108736Clone name: cLPT-10-D6
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E363888Length: 183 bp (1039 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E363888 [] (trimmed) AAAATCACACCTTTTATTTTCAAGAGAAGAGAAAATGGCGAGAATGATGTTACCATTGAGATCTTGCATTGTGAAATGCGTCATACGGATATTCA
TCATGTTAAGGATGACTGGGGCATTACTAAGTACCCTGTTGTGCCTGGGCATGAAATTACTGGGATTATAACAAAGGTGGGAAGGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E363888] SGN-U569435 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T179406 [Download] [View] Facility Assigned ID: TPTBN15TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0122 Quality Trim Threshold: 20.5