EST details — SGN-E363888
| Search information |
| Request: 363888 | Match: SGN-E363888 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C108736 | Clone name: cLPT-10-D6 |
| ||
| Library Name: cLPT | Organism: Solanum pennellii (formerly Lycopersicon pennellii) |
Tissue: leaf trichomes
Development Stage: 4-8 weeks old
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E363888 | Length: 183 bp (1039 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E363888 [] (trimmed)
AAAATCACACCTTTTATTTTCAAGAGAAGAGAAAATGGCGAGAATGATGTTACCATTGAGATCTTGCATTGTGAAATGCGTCATACGGATATTCA
TCATGTTAAGGATGACTGGGGCATTACTAAGTACCCTGTTGTGCCTGGGCATGAAATTACTGGGATTATAACAAAGGTGGGAAGGAAT
TCATGTTAAGGATGACTGGGGCATTACTAAGTACCCTGTTGTGCCTGGGCATGAAATTACTGGGATTATAACAAAGGTGGGAAGGAAT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E363888] | SGN-U569435 | Tomato 200607 | Build 2 | 11 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T179406 [Download] [View] | Facility Assigned ID: TPTBN15TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.931 | Expected Error Rate: 0.0122 | Quality Trim Threshold: 20.5 |
Working
