EST details — SGN-E364587

Search information 
Request: 364587Match: SGN-E364587
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C105437Clone name: cLPP-18-C1
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194801 [TUS-71-M7] Trace: SGN-T348608 EST: SGN-E547733 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C194801 [TUS-71-M7] Trace: SGN-T350459 EST: SGN-E549584 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E364587Length: 348 bp (768 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E364587 [] (trimmed) TCTCCCACCAAATTAAAGAAGAAAATAATCATCTTCCATGGGAGAATCTACGAAATCACCATCGTCTGCGTCAAAATATTATGGAATATTAGAAA
TTCCAAAATCAGCATCCCTTAAAGACATTTGCAAAGCGTACAAGCATCTTGTTAATAAATGGCATCCTGATAGAAATAAATCCAATCAAGCTGAA
GCTGTAAACAAGTTTCGATCCATCAATGAAGCCTATAGAGTTCTTAGCCAGAAAAAGAGAGAGGAAGCATATTTATTTAAGAGCGATACGGCAAA
AACACCTAAAAAAAGCTCAAAAGATGAGGAGGATGAGTTACAAATTTCAAGTCCTACACTTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E364587] SGN-U577027 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T177228 [Download] [View] Facility Assigned ID: TPOCQ13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.921 Expected Error Rate: 0.0194 Quality Trim Threshold: 14.5