Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E364765

Search information 
Request: 364765Match: SGN-E364765
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C110335Clone name: cLPT-4-H13
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: Alias clone SGN-C183232 is on microarray TOM1: SGN-S1-1-3.3.3.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183232 [TUS-41-K6] Trace: SGN-T196511 EST: SGN-E395185 Direction: 5' Facility: INRA
Clone: SGN-C183232 [TUS-41-K6] Trace: SGN-T199475 EST: SGN-E398149 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E364765Length: 645 bp (923 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E364765 [] (trimmed) CATTTCGAATCTTCTATCTTCTGCGTAGAAGCTACGATTTGGTTTTTGATTTTTTTCATCATCGAGCAATTTCATTGCTTTGATGCAAAAACAAG
AGGCATTTTCGGAGGGATTTGGTGCTGTTTTGATCTCTGGGTTTAGTTATGCCAGAGATCTTACGTGAGGAGAGCAGTTCATCTTCATCAACCAC
CGCCGGCACCATCACCGGCGCCGGCACCGGAGATTTCAAGCTTAACATATTTGGGAAATATGAGGTCGGGAAGCTTCTGGGTTGTGGTGCTTTTG
CAAAGGTTTATCATGCTAGGGATGTGAGGACGAGACAGAGCGTGGCGATTAAGACGGTAAGCAAGACGAAGATATTGAAAGGTGGTTTCACGGAG
CATGTTAAGAGGGAGATTTCTATCATGCGCAGGTTGCGTCATCCTCATATCGTGCGCCTCCATGAGGTGCTCGCGACGAAGACGAAGGTCTATTA
CGTTATGGAATTCGCTAAAGGTGGAGAGCTGTTTACGAAAGTTAGCAAAGGGAGATTCAGCGAGGATCTCAGCCGGAGATATTTTCAGCAGTTGA
TCTCCGCCGTTGATTATTGTCATTCTCGTGGTGTGTATCATCGAGATCTGAAACTGGAGAATCTGTTGCTTGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E364765] SGN-U574324 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T178166 [Download] [View] Facility Assigned ID: TPTAO43TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0099 Quality Trim Threshold: 14.5